નીચેની આકૃતિ કઈ પ્રક્રિયા દર્શાવે છે?

  • A
    આદિકોષકેન્દ્રિમાં સ્વયંજનન
  • B
    આદિકોષકેન્દ્રિમાં પ્રત્યાંકન
  • C
    સુકોષકેન્દ્રિમાં સ્વયંજનન
  • D
    સુકોષકેન્દ્રિમાં પ્રત્યાંકન

Explore More

Similar Questions

જો નિર્મિત mRNA નો ક્રમ $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$ હોય,તો તેના અનુરૂપ કોડિંગ સ્ટ્રેન્ડ (coding strand) પરનો ક્રમ નીચેનામાંથી કયો હશે?

$AGGTATCGCAT$ એ જનીનની કોડિંગ શૃંખલાનો એક ક્રમ છે. તો તેના પરથી બનતા $mRNA$ નો અનુરૂપ ક્રમ શું હશે?

નીચેના શબ્દોની વ્યાખ્યા અને સમજૂતી આપો: એક્સોન્સ (Exons),ઇન્ટ્રોન્સ (Introns),કેપિંગ (Capping) અને ટેલિંગ (Tailing).

પ્રત્યાંકન દરમિયાન $DNA$ શૃંખલાનો ન્યુક્લિઓટાઈડ ક્રમ $ATACG$ છે. તો $m-RNA$ નો ન્યુક્લિઓટાઈડ ક્રમ શું હશે?

યુકેરિયોટિક કોષોમાં પ્રોટીન સંશ્લેષણ દરમિયાન નીચેનામાંથી કઈ પ્રક્રિયા કોષકેન્દ્રની અંદર થાય છે?

Vedclass Products

For Students

Vedclass Test Series

Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.

Start Free Trial
For Teachers

Exam Paper Generator

Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.

Try Free
For Institutes

Online Exam Module

Live online exams with unlimited students, 360° analytics & white-label branding.

See Demo