$RNA$ પોલિમરેઝ ......... સાથે જોડાય છે.

  • A
    પ્રમોટર
  • B
    ઓપરેટર
  • C
    બંધારણીય જનીન
  • D
    નિયામક જનીન

Explore More

Similar Questions

સુકોષકેન્દ્રી સજીવોમાં $tRNA$ ના સંશ્લેષણ માટે નીચેનામાંથી કયો ઉત્સેચક જવાબદાર છે?

......... એક ટેમ્પ્લેટ તરીકે વર્તે છે.

$18S$ $rRNA$ નું સંશ્લેષણ કયા ઉત્સેચક દ્વારા થાય છે?

જો નિર્મિત mRNA નો ક્રમ $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$ હોય,તો તેના અનુરૂપ કોડિંગ સ્ટ્રેન્ડ (coding strand) પરનો ક્રમ નીચેનામાંથી કયો હશે?

નીચે એક ટ્રાન્સક્રિપ્શન યુનિટમાં $DNA$ ની કોડિંગ શૃંખલાનો ક્રમ આપેલ છે: $5' - AATGCAGCTATTAGG - 3'$. $(a)$ તેની પૂરક શૃંખલા અને $(b)$ $mRNA$ નો ક્રમ લખો.

Vedclass Products

For Students

Vedclass Test Series

Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.

Start Free Trial
For Teachers

Exam Paper Generator

Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.

Try Free
For Institutes

Online Exam Module

Live online exams with unlimited students, 360° analytics & white-label branding.

See Demo