Which one is the correct product of DNA depen | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) The process of transcription involves the synthesis of $RNA$ from a $DNA$ template strand.The $DNA$ template strand is given as: $3'TACATGGCAAATAT

Vedclass · Accepted Answer

$5'AUGUACCGUUUAUAGGUAAGU3'$

Vedclass · Answer

(D) The process of transcription involves the synthesis of $RNA$ from a $DNA$ template strand.The $DNA$ template strand is given as: $3'TACATGGCAAATATCCATTCA5'$.According to the base-pairing rules for $RNA$ synthesis:$A$ (Adenine) in $DNA$ pairs with $U$ (Uracil) in $RNA$.$T$ (Thymine) in $DNA$ pairs with $A$ (Adenine) in $RNA$.$C$ (Cytosine) in $DNA$ pairs with $G$ (Guanine) in $RNA$.$G$ (Guanine) in $DNA$ pairs with $C$ (Cytosine) in $RNA$.Applying these rules to the template $3'TACATGGCAAATATCCATTCA5'$:$T \rightarrow A$$A \rightarrow U$$C \rightarrow G$$A \rightarrow U$$T \rightarrow A$$G \rightarrow C$$G \rightarrow C$$C \rightarrow G$$A \rightarrow U$$A \rightarrow U$$A \rightarrow U$$T \rightarrow A$$A \rightarrow U$$T \rightarrow A$$C \rightarrow G$$C \rightarrow G$$A \rightarrow U$$T \rightarrow A$$T \rightarrow A$$C \rightarrow G$$A \rightarrow U$Thus,the resulting $mRNA$ sequence in the $5' \rightarrow 3'$ direction is: $5'AUGUACCGUUUAUAGGUAAGU3'$.

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Similar Questions

Compare the statements $A$ and $B$.
$Statement A$: $RNA$ produced during transcription in eukaryotic cells cannot be straight away used in translation.
$Statement B$: $RNA$ splicing phenomena helps in the removal of exons.
Choose the correct description.

If there are $81$ million bases in the $RNA$ of a human cell,calculate the total number of introns present in $cDNA$.

Choose the correct statement.

Transcription of $DNA$ is aided by

Which is the "Only enzyme" that has the "Capability" to catalyse initiation,elongation,and termination in the process of transcription in prokaryotes?

Vedclass Test Series

Exam Paper Generator

Online Exam Module

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?$3'TACATGGCAAATATCCATTCA5'$