Which of the following is not a part of a transcription unit in $DNA$?

  • A
    Inducer
  • B
    Terminator
  • C
    Promoter
  • D
    Structural genes

Explore More

Similar Questions

Which of the following enzymes synthesizes precursor $mRNA$?

The main enzyme for transcription is .....

During transcription,the site on $DNA$ where $RNA$ polymerase binds is called .......

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Which of the following enzymes can form $RNA$ from $DNA$?

Vedclass Products

For Students

Vedclass Test Series

Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.

Start Free Trial
For Teachers

Exam Paper Generator

Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.

Try Free
For Institutes

Online Exam Module

Live online exams with unlimited students, 360° analytics & white-label branding.

See Demo