Which one of the following is the sequence on | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In the process of transcription,the coding strand of $DNA$ has the same sequence as the mRNA,except that thymine $(T)$ is present in the $DNA$ ins

Vedclass · Accepted Answer

$5' ATCGATCGATCGATCGATCGATCGATCG 3'$

Vedclass · Answer

(D) In the process of transcription,the coding strand of $DNA$ has the same sequence as the mRNA,except that thymine $(T)$ is present in the $DNA$ instead of uracil $(U)$ in the $RNA$.Given mRNA sequence: $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$By replacing uracil $(U)$ with thymine $(T)$,we obtain the sequence of the coding strand:Coding strand sequence: $5' ATCGATCGATCGATCGATCGATCGATCG 3'$Therefore,the correct option is $D$.

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Similar Questions

In a transcription unit,which strands act as the template strand and the coding strand,respectively?

In eukaryotes,the $RNA$ polymerase that synthesises $tRNA$ is $RNA$ polymerase . . . . . . and is also responsible for formation of . . . . . . $rRNA$.

Methyl guanosine triphosphate is added at the $5'$ end of $hn-RNA$ in a process of:

What is the sequence of mRNA if the sequence of the coding strand in a transcription unit is written as $5'-ATGCATGCA-3'$?

What is meant by the sense strand?

Vedclass Test Series

Exam Paper Generator

Online Exam Module