In eukaryotes,the RNA polymerase that synthes | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(C) In eukaryotes,there are three types of $RNA$ polymerases in the nucleus:$1$. $RNA$ polymerase $I$ transcribes $rRNA$ ($28S, 18S,$ and $5.8S$).$2$.

Vedclass · Accepted Answer

$III, 5 S$

Vedclass · Answer

(C) In eukaryotes,there are three types of $RNA$ polymerases in the nucleus:$1$. $RNA$ polymerase $I$ transcribes $rRNA$ ($28S, 18S,$ and $5.8S$).$2$. $RNA$ polymerase $II$ transcribes precursor of $mRNA$,the heterogeneous nuclear $RNA$ $(hnRNA)$.$3$. $RNA$ polymerase $III$ is responsible for the transcription of $tRNA$,$5S$ $rRNA$,and $snRNA$ (small nuclear $RNA$).Therefore,$RNA$ polymerase $III$ synthesizes $tRNA$ and $5S$ $rRNA$.

In eukaryotes,the $RNA$ polymerase that synthesises $tRNA$ is $RNA$ polymerase . . . . . . and is also responsible for formation of . . . . . . $rRNA$.

Similar Questions

Describe the process of transcription in eukaryotes.

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

The sequence of nitrogen bases in a portion of a coding segment of $DNA$ is $AAT GCT TAG GCA$. What will be the sequence of nitrogen bases in the corresponding region of the transcripted $mRNA$?

Identify $Y$ in the given figure.

What is the effect of the association of various factors with $RNA$ polymerase?

Vedclass Test Series

Exam Paper Generator

Online Exam Module