What is meant by the sense strand?

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(C) The $DNA$ double helix consists of two strands. One strand runs in the $3' \rightarrow 5'$ direction and acts as a template for $mRNA$ synthesis;

Vedclass · Accepted Answer

The $DNA$ strand which has the same sequence as $mRNA$ (except $T$ instead of $U$)

Vedclass · Answer

(C) The $DNA$ double helix consists of two strands. One strand runs in the $3' \rightarrow 5'$ direction and acts as a template for $mRNA$ synthesis; this is called the template strand or antisense strand.The other strand runs in the $5' \rightarrow 3'$ direction and is called the coding strand or sense strand.The sense strand has the same nucleotide sequence as the $mRNA$ transcript,except that $Thymine$ $(T)$ is replaced by $Uracil$ $(U)$.

Similar Questions

What is the location of the terminator in a transcription unit?

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Which of the following joins the $RNA$ segments together during the splicing of $RNA$?

How many parts does a transcription unit consist of?

Which of the following enzymes synthesizes precursor $mRNA$?

Vedclass Test Series

Exam Paper Generator

Online Exam Module