$RNA$ પોલિમરેઝ $DNA$ સાથે ક્યાં જોડાય છે?

  • A
    સમાપક (Terminator)
  • B
    બંધારણીય જનીન (Structural gene)
  • C
    પ્રમોટર (Promoter)
  • D
    ઓપરેટર (Operator)

Explore More

Similar Questions

નીચે એક ટ્રાન્સક્રિપ્શન યુનિટમાં $DNA$ ની કોડિંગ શૃંખલાનો ક્રમ આપેલ છે: $5' - AATGCAGCTATTAGG - 3'$. $(a)$ તેની પૂરક શૃંખલા અને $(b)$ $mRNA$ નો ક્રમ લખો.

પ્રોટીન સંશ્લેષણમાં કયો $RNA$ $DNA$ માંથી માહિતીનું વહન કરે છે?

જો નિર્મિત mRNA નો ક્રમ $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$ હોય,તો તેના અનુરૂપ કોડિંગ સ્ટ્રેન્ડ (coding strand) પરનો ક્રમ નીચેનામાંથી કયો હશે?

આપેલ આકૃતિમાં $X$ ને ઓળખો.

$RNA$ ના સ્પ્લાઈસિંગ (Splicing) નો અર્થ શું થાય છે?

Vedclass Products

For Students

Vedclass Test Series

Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.

Start Free Trial
For Teachers

Exam Paper Generator

Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.

Try Free
For Institutes

Online Exam Module

Live online exams with unlimited students, 360° analytics & white-label branding.

See Demo