A: Sigma factor of RNA polymerase recognizes | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(C) $1$. The Assertion is correct: In prokaryotes, the $RNA$ polymerase enzyme consists of a core enzyme and a sigma ($\sigma$) factor. The sigma fact

Vedclass · Accepted Answer

Assertion is correct, but Reason is incorrect.

Vedclass · Answer

(C) $1$. The Assertion is correct: In prokaryotes, the $RNA$ polymerase enzyme consists of a core enzyme and a sigma ($\sigma$) factor. The sigma factor specifically recognizes the promoter site and initiates transcription.$2$. The Reason is incorrect: The promoter region is defined with respect to the coding strand. It is located at the $5'$ end of the coding strand (upstream), not the template strand. Therefore, the statement in the Reason is scientifically inaccurate.

$A$: Sigma factor of $RNA$ polymerase recognizes the start signal region in prokaryotes.
$R$: Promoter region lies at $5'$ end of the coding strand, not the template strand.

Similar Questions

The sequence of nitrogen bases in a portion of a coding segment of $DNA$ is $AAT GCT TAG GCA$. What will be the sequence of nitrogen bases in the corresponding region of the transcripted $mRNA$?

Which structure is responsible for the synthesis of $m-RNA$?

If the sequence of nucleotides in a template strand of $DNA$ is $3'-ATGCTTCCGAAT-5'$. Write the sequence in the corresponding region of the transcribed mRNA.

In which of the following places is messenger $RNA$ $(mRNA)$ formed in a living cell?

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Vedclass Test Series

Exam Paper Generator

Online Exam Module

$A$: Sigma factor of $RNA$ polymerase recognizes the start signal region in prokaryotes.$R$: Promoter region lies at $5'$ end of the coding strand, not the template strand.