RNA polymerase II is responsible for the tran | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(A) The correct answer is $A$ (hnRNA).In eukaryotes,there are three types of $RNA$ polymerases in the nucleus.$1$. $RNA$ polymerase $I$ transcribes $r

Vedclass · Accepted Answer

hnRNA

Vedclass · Answer

(A) The correct answer is $A$ (hnRNA).In eukaryotes,there are three types of $RNA$ polymerases in the nucleus.$1$. $RNA$ polymerase $I$ transcribes $rRNA$ ($28S, 18S,$ and $5.8S$).$2$. $RNA$ polymerase $II$ transcribes the precursor of $mRNA$,which is known as heterogeneous nuclear $RNA$ $(hnRNA)$.$3$. $RNA$ polymerase $III$ is responsible for the transcription of $tRNA$,$5S$ $rRNA$,and $snRNA$ (small nuclear $RNA$).

$RNA$ polymerase $II$ is responsible for the transcription of . . . . . .

Similar Questions

If one strand of $DNA$ has the nitrogenous base sequence as $ATCTG$,what would be the complementary $RNA$ strand sequence?

$A$ gene that contains many exons and at least one intron is called a.....

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

If the sequence of nucleotides in a template strand of $DNA$ is $3'-ATGCTTCCGAAT-5'$. Write the sequence in the corresponding region of the transcribed mRNA.

What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?

Vedclass Test Series

Exam Paper Generator

Online Exam Module