The removal of introns and joining of exons is known as.......

  • A
    Capping
  • B
    Tailing
  • C
    Splicing
  • D
    All of these

Explore More

Similar Questions

Which enzyme is responsible for the synthesis of $18S$ $rRNA$?

What is the location of the terminator in a transcription unit?

Segments of $mRNA$ removed during splicing are called......

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Identify the correct statement.

Vedclass Products

For Students

Vedclass Test Series

Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.

Start Free Trial
For Teachers

Exam Paper Generator

Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.

Try Free
For Institutes

Online Exam Module

Live online exams with unlimited students, 360° analytics & white-label branding.

See Demo